EST 1736849 is a singleton


Sequence

>1736849 (1 EST) Length=556 ATTTTTTGAAAATCGACGAGAAAGGGACTAACTTCTCTACGGATATTTATGATCCCTATCGTTGGACTCCGCAGTCATAC TATGAAGAACTTGCAAAGGTGCAAAATCGTGAAATCGACAGACTGATGAAAATGCAAAAAGAACTTAAAAAATCTGACCC AAATACAACGAATGCAAACAACAGCACAAGTGCAAATGCACCTAAAAATCCAATTACTAGCACAGACAAACCCAGTGCAA CATCTGGAGGGTCCGTTTCTACGGGGTACATAGAGACTGTTACGCAATCTGATGTCTGGAAGGCCTTCGGAATAACATTA CAGTCTTCTTTATCATCAGAATCTCGACTACAGAAATGTTGATCAAGTCTCTTCATATCCTCTGGAAAATTTGAATACAA TAGTTTTTTTATGGATCGAATACGTTTGAAGACATCATCCANTTTCCTTTTTTAGTGATATTATTGTCTTTGTATGAGCA GTTAGTTCTGTAAACAGTATTTTACATCTTCCGTCAGAGAGCTCAGAACAGGTTCNGAAGCATCTCATTTGNTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1736849: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17368493189769AA999214MCCE0217.M1RSchistosoma mansoni, cercariae


Date: 17:19:22 on Wed 22 Nov 117.