EST 1736857 is a singleton


Sequence

>1736857 (1 EST) Length=313 GAAGGTTACATATAATACATTGGTTAGCGAAATTAAGGNATACAATGGATAAATTATGCCTCTGTGTCCATAGCTTCACC AGATGAGTCGCTTTCAGGGGAAATATGTGAAATGAGGGGGAACTCTGATTGTACGTTGTCGGGAGAAAAATGGTCCATAT CTTCAGGGCCTGCTAGCTTCACCCCTACAACTGTAGGTTTGGGCGGTTGCTCGTTACTAGACTGAGTGTCATCATCACTC TGGGCCTTCCCATTTTCCATACTTTCAGCAGGACAAATCTTACAATTTCCAACTCCACTGCCACTGCAACTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1736857: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17368573189777AA999222MCCE1024.M1FSchistosoma mansoni, cercariae


Date: 0:46:15 on Fri 24 Nov 117.