EST 1736860 is a singleton


Sequence

>1736860 (1 EST) Length=342 AACTCCAAAATAGAGCTTTAATAACATCTCCCGTTATGGCGACGGTCAAGCTCCATTTATGACTTTCTTCTATACAACTC CTTCGCCCTCTGAACAATCTCATTACATCTCTTCTGATATTCAATCACCTTAGCCCGATAAGTCTCGTCCAGGCTTTGCT TGTACTCAAGAATCCTCTTTCTACAAGCCTCCTTGCATTTTTTTCTCTTCTCCAGGAACATCTTGTCATACTGTTTCTTG AGATCTTCTATCTCCATCTTCTTCTTGGCCTCCAGCCGCTGCCTTAGCTCAGACACTTCTTTTTCCCATCGCCCTGATCA GTCTACTCCGAGCCTTCAACGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1736860: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17368603189780AA999225MCCE3004.M1FSchistosoma mansoni, cercariae


Date: 2:30:8 on Thu 23 Nov 117.