EST 1736866 is a singleton


Sequence

>1736866 (1 EST) Length=350 ATTTACAGAACTGTATTACATGATCAAAATATAAAGAAAGAACTGTACAAAAGTATCGACAACTGTTATTCGCAGACATA AGTGGTACGATTAAATCAAATAAACGTTGGACAAATAACGAAGATATCCAAGATTTAAAGCACATCCATTCTCCAATAAT ATTTCATCTGGNTTGTTAGCATTAAGTTCAGGNTTATTGATTCGGGCTTTGAATTTGGNAGACTGTAAAAGGGCCCCACG ACTTGAAGCAGAACGTTCGAGTGCTGATAGCAAACGAATATTCCATAAATAAGGTATCAAATTATCGGGACAATCTAATG TAGTATGAAGAAGTGAACCTCCACAAGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1736866: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17368663189786AA999231MCCE3013.M1FSchistosoma mansoni, cercariae


Date: 21:19:43 on Fri 24 Nov 117.