EST 1736881 is a singleton


Sequence

>1736881 (1 EST) Length=381 CTAAATAGAATTCTTAATCTGTCTGTATCTTATTCTACGTATATTTTGTAAATTGGATACAGTTTGAATACTATGACAGA TATTACTATTTAATATAATAACTAGTAATATCATTGTGATCATCAATAGTTTCTATTTTAGTATGTTTTGTTTTTGATCC ACTATGGCTGTGCTTTTATCCTCATTGCCCTCACCAACAGCATTCTCTGTTTTCCTGCATAGACACATAGTTCACATCGA TCCACAGTACTTCACATCCAGGTTGTTTTTAACATATTTACTGTTTGTTGTTTACTTTATCGTTTCTTCGTCATGTCCTT TCTTGATATTTAAAAAACTAATTCAGTTTGTNTTTATTTTAAAANTGTTATTGTCACAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1736881: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17368813189801AA999246MCCE3033.M1FSchistosoma mansoni, cercariae


Date: 12:48:59 on Tue 21 Nov 117.