EST 1736885 is a singleton


Sequence

>1736885 (1 EST) Length=347 CCGTATCCTTAACAGTAATAATAATAATAATAATAATAGTCAACAATGAGTACTGAGAACGTTTTCCAATATTCTTTTTC AATTCATGGATCTAGAGTGATTTGTATGTTAAAACAAAAAAAAATTAGATTTACTATTAATGTTGATTATTGGTCATTGT CACAGTCACCATCACATCTGCCATCCTCATCCTTAATGTTAATTATTTCGATAGGTTTTCTTCATTAAATTCTAAAATGC TGCTTACTATGTATGACCGTCCTCCTCTTCCTCATCACCATCATCATCATCATCATCATCACCACCCGACATCATCATTG AAAATGATCTTAATAACATGTGACAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1736885: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17368853189805AA999250MCCE3044.M1FSchistosoma mansoni, cercariae


Date: 13:6:12 on Sun 19 Nov 117.