EST 1736886 is a singleton


Sequence

>1736886 (1 EST) Length=169 TCCCGTCAGCATTTATTGAGAGAAAAAAATCCAACAAGTTTGTNCACCAAAAACAAAAAGAACCCGGGCCCATGAAGTAA GCCGGTTTGGNAATAAACCAACCAAATAAATTTCCCNAAAAAATATTTATATATATGGTGTTGTGTGTGTGCTTAAAATA GTATAAACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1736886: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17368863189806AA999251MCCE3045.M1FSchistosoma mansoni, cercariae


Date: 21:24:28 on Fri 24 Nov 117.