EST 1736890 is a singleton


Sequence

>1736890 (1 EST) Length=152 CTCGTGCCGTGCAACAGGAACAAAAGCAGCAATGGATGANGTAGTCAAAGCTACTAAAAATGGTGCTACAACTATTATTG GTGGTGGTGACACCGCAACCATGCTGCGCCAAATGGGCACACAGCCAGCACAAAAGTTCAGTCCATGTCCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1736890: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17368903189810AA999255MCCE3052.M1FSchistosoma mansoni, cercariae


Date: 22:57:26 on Wed 22 Nov 117.