EST 1736901 is a singleton


Sequence

>1736901 (1 EST) Length=322 AAATAATAATAGTNTNTGNNCCAAATAATAATAATTACACAATTCACACCAGTTTACAGACATGNNCAATTTGNNCTATA TAGCAACATTAGATGTAGAGAAAAACCATCGGACACAGGGGATTNTTTTCAGTTTACTACTTCAGTAATTGTTTATGGCG TTTATTTATGACATGTATCACGGTAATCCAGCAAGGNTCTTGTTATTTTTCACTTAAGTGGATAGACTGATGATTTATGA ACGGTGTTGTTTAAGGTTATTCCCAAGGCCACGGCGGATGATTGATAATTACCTTCAACTAGNGAAAGTCAAATTAAAAC AG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1736901: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369013189821AA999266MCCE3067.M1FSchistosoma mansoni, cercariae


Date: 6:4:6 on Wed 22 Nov 117.