EST 1736907 is a singleton


Sequence

>1736907 (1 EST) Length=416 ATTATTAACAAGAAATCTATTTAACGTTTAATGAATCTNTTCAGGTGATTTGAGATCACAGTGACCTTAATGAAGATAAT CGTTGCGTACAGACACAAGTATGGAGTGAAAAACAGATAAATGTGCACAAATTTGTGTGTGCAAAGACTAGTTTGTTTCT CGAGTTTAGATTAGAAATGAAGTCATTGAACAAATGATAATGGACTTACGGAGGCTTTTATCACTCGTGAAGATAATACT GATTATAAATTGGGATAGATGAAAACAATTAAAGCAATAATGCATACAAACACGCAAAGAAACGGGTGAACTTAAGATTG TTTCAATAGTATTTATGACTAGAAAATGTTACTTCATGTTATAAAATAACCCTGTCAGGCATCCATGATGTGTTACAGAG CTATATGACCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1736907: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369073189827AA999272MCCE3073.M1FSchistosoma mansoni, cercariae


Date: 21:14:44 on Fri 24 Nov 117.