EST 1736911 is a singleton


Sequence

>1736911 (1 EST) Length=249 AAAGAAAAACTATTCATTACAAATTTGTTAATGATAGCATAGAAGCAATGATAAAAACAGATCTATGATAAACAATGTAA ATAAATACATTTCTTTTAGAATAAAAGATCATTTTGGTAAATTTTATGGATCAAAAATTGATCTGAAAAATAAAAAAGAA ACCATAGTGAATGTTAAAGCAAAAAGCGATAAGAAAAAATTTGTGTTTGTCTCTTGATTATAACTCCGCCTGTAGCTCTT ATAGAGTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1736911: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369113189831AA999276MCCE3078.M1FSchistosoma mansoni, cercariae


Date: 6:50:7 on Sat 25 Nov 117.