EST 1736914 is a singleton


Sequence

>1736914 (1 EST) Length=342 AACCCTTGTATAGCTACCTAACTACTACGAATATTTAGCATTACTTAACTACCCATAACTTAGAAGCGTTTAAATACTCA ACATGACTGGGAACAGGACCAGTCATCACTTTCGCTCGATGCCGCGCGCTGTGGAATTCAGCACGACANGATATTGCAGT TAGAATGGTCAACCGTACAGAGGCGTGCACAACTTTGTGAAGCACCTTGNTTGTGATAAACGTGGAAAAACTTAGTCCTC CAAGGAGTTAATTGGAATTTTTGCACACCGGTTACACTGTCCATTCAAAGGAAGATCTAGTTGAGAAGTTTATCAGTCGT GGCACGACAAAGACGGAGATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1736914: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369143189834AA999279MCCE3085.M1FSchistosoma mansoni, cercariae


Date: 9:30:26 on Sun 19 Nov 117.