EST 1736915 is a singleton


Sequence

>1736915 (1 EST) Length=605 AGTTATTTAGAGATTGTATTTTGTTCAGTAATCACATAAAAATAATTGTAATCAGAAAATAATAGAAAACGACGACCAAT GTATAAAATTAACAAGCTTAAATAAGACGCTAAACAAAGTTAAGCATCACAAATGAATCAGTTTATGTATTAAAAAATTG CACAATTTCAATAAGAGTCAATAATCGTGTGAATAAACGTTTATGTAAAAATAGTGTAAACAGTTTTTGAACATTCTTCT ACACGTTGAACTGAATCATAAAATGATTGCTATAGTTTTTGATCTTGTATACACATTGTACCACCGCCACGTTCAAATTG ATGAGGCTGTCGGTTAATGTCACCAAGACAAATCCAATTATTCGTATCTTCAGTTGGTTTTTTCGAGGGCACAGTAACAG CCCATTTTGCATGATCTTGTGCATTCCGTATTGTGGTTCCAGTAGCTCTAATGTAAATAGATTCAATATTTTTCACAGAA TATTGCCGATGACATGCCGTTGGTATACTCCCGTCATGTTGCCAAGTTTCTTGTATCTAAAGACTTCTTTAATTTTTGGC GGTACGAAATCGGCATAAAGTCTTTACCGAATCTGTGTTTTGAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1736915: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369153189835AA999280MCCE3086.M1FSchistosoma mansoni, cercariae


Date: 19:19:59 on Wed 22 Nov 117.