EST 1736920 is a singleton


Sequence

>1736920 (1 EST) Length=338 GAACAATGTTACAACATCATGTAAAAATTCGCCTCGAGTTTATGATCACGAAACCATTGACATTGATTGATNAAAATTGT GTAAATTCCCTGTCCTCCTATTTCATTTCGTACTTACAAATGTATTTATAATTGAGTTTTTTTTTCTTTGTGTCTATTAA TATTTATTAACGGAAATGCAGAATGGCGCGTTTACCTCGAGACATTTTTCTCCTCAGAAGTAGGGTGTTTTTCTTCAAAT CGCTTTATCGGTAAACACAATTTTGTTTTTCTTTTATATTTTAAACATAGATTATTACTTTTCCTAATTATTAGAAAATG TTTTATCTGCAAAANANA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1736920: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369203189840AA999285MCCE3094.M1FSchistosoma mansoni, cercariae


Date: 3:4:16 on Tue 21 Nov 117.