EST 1736926 is a singleton


Sequence

>1736926 (1 EST) Length=200 CAGGTAACGAACTTTATTTTAAAAGAACTAATAGGATTTCAAAAAATTCATTTGGCATAATCACTTGAAAGTAAATCTAC GGGAATTTCTTGCTCACGAAGTCAACTAAAACACTTTTTCCTTTTCAGGNCCAAAACGTTTGACCCAGGCTTCCAAAAAT TCCTTCTTACGTTTTTCCCGTCTTGCAAAGAAGTCAGGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1736926: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369263189846AA999291MCCE3101.M1FSchistosoma mansoni, cercariae


Date: 1:55:27 on Sat 18 Nov 117.