EST 1736929 is a singleton


Sequence

>1736929 (1 EST) Length=379 AACCTTATAAGACTATATGCATAAGGGTATATATTTTCCCGAATTCTATTCGGTTTATTAAAATAATTTTGAACTGAATC GAATAAATGACTTCCAGAAGAGAAATCCTGACACTTTACAAAAATCTCTTAACATATGTGAATAACCTAAAGCATTCCGA TAAAAGTTATCTAAAAAAGAGGATTCAGTCTACTTTTAAAGAGAATAAAGGGTCTACTGATGATGATGAAACAACACGAT TGTATAAGAAAGGTTGTGAGATTCTACGACTTAAAAGATTTATCTAAATTTTGCATCGGTGTACATTTCCCTTCGTGATT TCATTCAGTTCATGTAATTTGCTGTTTTCCCAGTGATTTATTTCCCCAAATTAAAATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1736929: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369293189849AA999294MCCE3106.M1FSchistosoma mansoni, cercariae


Date: 17:56:22 on Fri 17 Nov 117.