EST 1736939 is a singleton


Sequence

>1736939 (1 EST) Length=358 AAATTAGCTCAACATTTTATTGCACTATCTAATAATAATAATAATAATAATAATAATTCTATGAATTCAAATTTTTCACT AAAATCTAATTCAACCGATTCACAATTAGGACAATATCATCATCAGCAGCGTCAACAATCCAACGAATTTCACCAACCTT CTTTACAGCGTCCGTATAATTGTCAACAGTTAATTCCGTCATTAGTCAATTCGAATCATGAGATGAAATTATTGAATCTA AATGATACCTCAAATATACAATCGTTAGATCAATTAACTGAATTATTGTTATATCAACAATATTATCAAAATAATCTATA ATAATAATAAGCATATTATACCAGAAATACAATATCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1736939: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369393189859AA999304MCCE3118.M1FSchistosoma mansoni, cercariae


Date: 4:32:13 on Mon 20 Nov 117.