EST 1736940 is a singleton


Sequence

>1736940 (1 EST) Length=186 ACCTAATAGTTATTACTTTCCTAATTCCCTCATTACGTTACAGTATAACTACTCGTAATACCTCTAATTAATACCCTCTT CTCGTATACTCTATATCTCTAGTATACTCTATATTTCATCTAGGTATCTATATGTATCCCTCTATATCTCTCTGGGTCTT TCTATCTACCCCCGGGTTTCTTTTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1736940: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369403189860AA999305MCCE3119.M1FSchistosoma mansoni, cercariae


Date: 4:14:54 on Wed 22 Nov 117.