EST 1736947 is a singleton


Sequence

>1736947 (1 EST) Length=356 ATATACTCAATTTATATTTCTACAATATTTATTAGCAAGCAAAATAAAATAGGTCACAACTGAAGTAGCTGCTAAAGTTA GCAACAAGAAAAATGTGAGCNATCTGATAACGTCATTTCGATCCAACCCGTGTTCGTTTGTTCCATGAAAAATTGGATCC ATAGGACTTGATATTCATTTTCAAAATATTTGGACTTTCTACGTAACATGGCCATCCCTGTCGTTGGCAAAACTCTTCTG CCGCTTTAGAAGTTTCAAATTCAACAACTGTATTTGAAAGTGGGTCACCGGTGCTCGCCCAACCCATCAGTGGATTTTCC CAGCGTTCGCGATTGTCGAACTCAATAACGCCAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1736947: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369473189867AA999312MCCE3126.M1FSchistosoma mansoni, cercariae


Date: 18:42:50 on Thu 23 Nov 117.