EST 1736948 is a singleton


Sequence

>1736948 (1 EST) Length=243 ACTGCTACTAAATATTAAAAAGCAATGCATATCAAATCTGCATCGCAATGCAATAATGCTAAAGCTCAGCGCAGCAAGCG CCAGCTTCAAGCAAATTTTAGCGCCAGCGCAAAAAATTGCATCAAAACTTTTTCCACACCAAATTTAAACCACATTTCCA TTTCCTCCATTTCCCCATTTAAGGCTTCAATCATCACACGCGCCCATCATTTCACGCACACAAATTTCTTTACAACGCTC ACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1736948: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369483189868AA999313MCCE3127.M1FSchistosoma mansoni, cercariae


Date: 9:35:3 on Fri 24 Nov 117.