EST 1736949 is a singleton


Sequence

>1736949 (1 EST) Length=267 GATAAATTCTCTTTAATAGAATCTGAATGACATTTTGAAGAGTGACATATATTTTTCTCCACAGAATCAACAGTAGAACT ATGAAAGCAAACAGAAGTAAAATAATCATTTTAATTAAATATTAAACATATAAAANAGAAATGTATTTTTGCTATTAAAT CTCATTGATGAAGTTGGAAGAGGAATAGGTGTTAAACAACTATTGTTTACTGTTTATCACAGATTATGAATCATAAGTAA CAGGTAAATAATAAAGGAGAAACACTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1736949: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369493189869AA999314MCCE3128.M1FSchistosoma mansoni, cercariae


Date: 9:11:35 on Sat 18 Nov 117.