EST 1736955 is a singleton


Sequence

>1736955 (1 EST) Length=265 GGTATAATGAAACTAATTTATTTAGCCACAACGTATTTCGTGTAGTTATGATGAGTCAACTAAAAGACACCACTTGCAGT GAACAAACTATTTGTAATAAAGATGCGATTGACGCTACACAACAAAGGAGATAAATGTATGGGTTTTACAAAGTAAAATA CAATGTGAAAATACGAGGTGAAATACGTGGATTTCAAGTTTTAGTGAAAAAAAAACGTTTCGCAAAATCAGTCTCTGGCC CAAACTGTTTTTAAGTTTATTGTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1736955: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369553189875AA999320MCCE3134.M1FSchistosoma mansoni, cercariae


Date: 8:52:47 on Mon 20 Nov 117.