EST 1736976 is a singleton


Sequence

>1736976 (1 EST) Length=334 ACGCTTTAATTCACATATTTATCATTATCATAATCATTATTCTCAAATCAAAACATATTTCGCGCTAATTACAAACGCAA AACAAAATGCTTTTAAAGCAATAATGCTTTTCAAATGGCTTAATCGCTGCTTTTTAGCTTATATTGCAATAAAGCGCCAT AATGCCAGCTTGCCAATTNAGCAAAAGCAAAGTTATTAAGCGCCGCTAATATGCCTTGCTGCTGNAATGCTAGCTATTAG CATTAAGGCATGCCGTTAGGCTGCTAGCGCCGGCTTTTGCGCCTTTGCGCTGCTAACTTGCAATGCCTTGCTGCCAGCAA ATTTTTTTGCAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1736976: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369763189896AA999341MCCE3165.M1FSchistosoma mansoni, cercariae


Date: 20:52:56 on Sun 19 Nov 117.