EST 1736978 is a singleton


Sequence

>1736978 (1 EST) Length=228 ATTTTACAAATTTATTTATATCATATAAAATAAATTTTTAAGAATCATTCTTGTTGGACAAATGGATTAGGTATAGACTC CATTCCATCTGCAGGACAAACAAGTTCCACAGATGGACCCCTACAAACCACAAGGGCAAGTTCTCTTGTATCTTCGGTCA AACGATGAGGATCATCTGGATCACGAAGGAATTCAGTAGTACATTTAATCACCATATTCTGTAAATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1736978: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369783189898AA999343MCCE3168.M1FSchistosoma mansoni, cercariae


Date: 19:23:21 on Fri 24 Nov 117.