EST 1736987 is a singleton


Sequence

>1736987 (1 EST) Length=218 ATTTAAAGATGTATATTACCGGTTAGATTTTGCAACACGTTCCAACTCGTCCTTCTTTTTGATTGCATAGGAATTCGAAC TACCTTTAGCGGCATTGAGAAGTTCATCGGCTAAGCATTCTGATATGGTCTTAACATTTCTGAAGGCTGCTTCTCGAGCT CCAGTACACAAAAGATAAATCGCCTGGTTTACTCTGCGTAGAGGAGGAGAACATCAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1736987: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369873189907AA999352MCCE3189.M1FSchistosoma mansoni, cercariae


Date: 14:33:54 on Fri 17 Nov 117.