EST 1736993 is a singleton


Sequence

>1736993 (1 EST) Length=282 GCCCCGGAAACAAATTTTTTTTAAAAAATCATAGAATAAACAAAACTATTCATGAAAAACTTCTTTTGTAAAAAAAAAAG AAAAAGTATCAGACAATCATTGTCTAAACAATTGTTTCTCATTGATTCCTTCATGAACAGTTCGTAAAAATAACAGTTAA AATGTGGGAAAAAGCAGTGGAGTCATTTTTTTAATTAAAAAAAAACAGTAACCCCCCCACAGGTATGGTTTTCTTAACTG AGAAAAGGNAACCTGTCTAATCAATTAATATATATATCATGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1736993: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369933189913AA999358MCCE3197.M1FSchistosoma mansoni, cercariae


Date: 2:21:14 on Thu 23 Nov 117.