EST 1736994 is a singleton


Sequence

>1736994 (1 EST) Length=201 AAAATATGAAAGTTTATGTACCAGAAATCGAAATCAGAGAAAAGCAAACAAACTGGTTAGATAGATTATTCATTTATATA GCTGTTTTACTGAAACTGATACGCAAATGGGAATTTTCTGTTAGCTGACAGTTGTGAAGGTCAATCAAGGCTTGGATAGC CATATCAACGTTTTCCAGTTGGATTAATGCCANCTTTTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1736994: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369943189914AA999359MCCE3198.M1FSchistosoma mansoni, cercariae


Date: 23:51:55 on Sat 18 Nov 117.