EST 1736997 is a singleton


Sequence

>1736997 (1 EST) Length=150 CTTTGTAAAGTTTGTGTATGCTTTTGGTTATAGGTTATTTTGGTGATACATACCACTAATGAGGTANAACCCAAACGAAT ATGATGCTAATATAAATGTGCCAAAATACCGTATCTATTACTTACTCAAAACACCTGCTTTGCTCAATAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1736997: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369973189917AA999362MCCE3202.M1FSchistosoma mansoni, cercariae


Date: 16:17:27 on Fri 17 Nov 117.