EST 1737008 is a singleton


Sequence

>1737008 (1 EST) Length=295 AATAACATCGAATTTTTTATTATTATTACTGTTGTTAACAATGAATATGAAACATAAATATTCTAGATATAAACATAAAA ATATAAACAACTAAAGTAAACAAAAGGAAACTAAAATTATTGACTTGAAAATATAAACAACAATTGTCAAAACAAATATA GATCTAATTGACAAAAAACATTTGTGAAATGACTAAGGAGAAAGAAGGAAAAGAAATTAAAAAAAAAGAGAACAACAACA AAAGAATTCAAGAGATAAGTGAAATTATAAACAACATGAAAAGCATGAAAAAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1737008: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17370083189928AA999373MCCE3217.M1FSchistosoma mansoni, cercariae


Date: 11:46:32 on Fri 24 Nov 117.