EST 1737009 is a singleton


Sequence

>1737009 (1 EST) Length=185 ACAGTTGCAAACAGTAGATTTTTTAGAAATTATTTTAGCGACTGTACATGCAAAGTAGATACAAAATGGATAGTGAATTC CTTGGGTATATTACAAATCTGGAGGCTTCTCTGGAGGAAAAGGAGGACATATCATATTTGTTTATTGTCAAAGGGTTTAT CAACTGGAAAATTCGGAGACGAGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737009: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17370093189929AA999374MCCE3218.M1FSchistosoma mansoni, cercariae


Date: 2:34:22 on Wed 22 Nov 117.