EST 1737010 is a singleton


Sequence

>1737010 (1 EST) Length=411 AAATCATCACTTTATTTATTACCATTTTACTGTATGAAATTGAAATAATCATAAAAACTGTTATTAATTTAAGCAAACAA GACAAGAAAAGTATTAAAAAAAGCACGGAGATTTGGAAAAATCTAATTCAATAGAATTTCTTGTAATTTTATAATAAGCA CTTTCAATATGCCAATGTAATTTTAAAAAGTACTGATATCAAGTTTTTTAGAAGTCTTTGACAAAATAGAAAGAAAGAAA TACAAGTAAGGCATTTATTTGAAAGAAACTATTTTGGGAGTGTGATAAAGTATGCCCAAAACTAGGGAGTTAATATACTG AATAGATTTACTCCAATTTTTTTTGTCCTCACCTTAGTTAAATCAAATTGATGAGATACAAGTGGGAATACCATCACGGT TGTTTATCACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1737010: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17370103189930AA999375MCCE3219.M1FSchistosoma mansoni, cercariae


Date: 19:49:37 on Fri 17 Nov 117.