EST 1737011 is a singleton


Sequence

>1737011 (1 EST) Length=261 ACACAACAAATTAATGTATTGGTTTATAATATAAGTGCATATGAAGATGATAAGCGTGAATTAGGTATGAAAATACAATG AAGGCAACAGTATGAGTGAACGGTACAGTGAAAATAGCGTGTATATATACGTAAGCCAAGTAAATAACAGCGGAAAAATA GCATGCAGATAAGGAGACGGTAGAGTGGAACGAAGATTTCGTTTATATAATGACAACGCAACATGTTTGCTCTAATTAAT GTATATATATAAAACNACAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1737011: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17370113189931AA999376MCCE3220.M1FSchistosoma mansoni, cercariae


Date: 11:50:16 on Wed 22 Nov 117.