EST 1737015 is a singleton


Sequence

>1737015 (1 EST) Length=176 AAATTATAAATGTTTATTTAAACAAATCACATGAACAATATAAACTCTTCAAGTCAGAACTTAATAAACTGAGTTCATAA TTAAAGGGTACTTAAAAGTGAAACATTGAGGAAACATAGAATGATAGTTTCTAAGTTTAAATTTCAAATAAAATGATTGT TTAAATAAGATAGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737015: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17370153189935AA999380MCCE3224.M1FSchistosoma mansoni, cercariae


Date: 1:8:39 on Mon 20 Nov 117.