EST 1737021 is a singleton


Sequence

>1737021 (1 EST) Length=289 AAATGATCCGTTGATTTTAATTACACCGCGATCATCATCATCAGTATATANACGCACATAATATATATATGAGACATATA TCAACACATACATGTCACCCTATATGANAACCAAACCCGACGTAATATGCAATGTATTAAGTATCTTAATAAAAANAGAG TTGATAATACCTTGAAACTAATCATAGCAAAGAATGAGAAAATCGAACTAGATACGTTTTTTTTGTTGTTGAAAATAATA TATAGCTAGTCATTTCTTAATAACTATGCACTACTTAAGAATTGACAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737021: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17370213189941AA999386MCCE3230.M1FSchistosoma mansoni, cercariae


Date: 9:22:44 on Sun 19 Nov 117.