EST 1737025 is a singleton


Sequence

>1737025 (1 EST) Length=313 AATCAATAAATAAAGATTATCTATTACGATTGCACAGATACTTTTGTGTGTATGTGTGTGTATGTGTGTGTGTGTGTGTA GAAATATGGGAGATTGCTGTCGTTGAAACCATCGGTTAGGTAGTAATAACAATAATAATAATAGCAATATTAATAATACA ATAAATGAAATGAATAAAAAGGGCAAAGGGAAAATGTGAGAGGAGGAAACAAATTTCTGAAAAAAAGAAAAAAAGAGGAA AAGAGAAAAGAGAAAAGAAAAAAAAGAGAAAAACTAAACAAGGGTAAAAGCAATAACTAAATTTTTTTAGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1737025: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17370253189945AA999390MCCE3235.M1FSchistosoma mansoni, cercariae


Date: 15:16:58 on Fri 24 Nov 117.