EST 1737039 is a singleton


Sequence

>1737039 (1 EST) Length=276 GCAGTATTAAAAAATGTATAGGATAATATATATGAACATGTTAAGCACATCAATATTTGGCCTTTCAACCACTTTGATCA CCTGAAAGGAAAGAAAAGGGCTTGAAGTTATATAATGACAATAAACCAGATTTACAAAATTTTTTCAAACCTACAATTTT GAATATCGCTACCCCAGGTTTTCTAGCCAAAACGGACAACCAAATGTATCGCCCCTGATCATTTGCAAGGGCATATATGA ATATTCAATATTTGAATAAATAACCCTTTTGTACAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1737039: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17370393189959AA999404MCCE3255.M1FSchistosoma mansoni, cercariae


Date: 20:59:23 on Wed 22 Nov 117.