EST 1737041 is a singleton


Sequence

>1737041 (1 EST) Length=328 CACTCAGAATAAATTTCTTTGACAACAAACAAAACGTTATTTTTTAGATGAAAAACTTAAACCCGTTTTTTTTACCTTCA ATGGTAATTTTTATATTTCAGTTAACTTTTGTAATAAAACCCTCCTTTTGAGAAGCAATACTCAGCAATTTAGGAATTGA GAAAAACCTTAGGCTTACCCAGCTATGTATTGTAGTATAAAACCAATCCCTTCCCCAATAACTCCAAGTACGATAGGGAC AGCCGCCGCAGCCAGCACAACACGTTCATCATGTGGTTTCTTAGGAATAGATGCTGCAGGTTTAGCAGTATTAGAAGCTG CAAGTTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737041: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17370413189961AA999406MCCE3258.M1FSchistosoma mansoni, cercariae


Date: 12:49:45 on Fri 17 Nov 117.