EST 1737042 is a singleton


Sequence

>1737042 (1 EST) Length=501 ATATATATACCTGTATATAAATCTATATATGTATATGCATAATTATAAATAAACAAAAAATATATACCAAGCATGTTACT CAAATATAAAGAAACGATATGAAATATATCTAACGGTTCATTCAAATTCACAAGAACAAATTATTGAAATACAGATATAG GGTGAAAGGNAACTACACACAACCGAACAAATACATTTGACAGTTTCATAAAACATATTGTACAATAAAAAAACGAGCAT CTCACAATCAGTGCATTGTGAAAACTATGGGGGGGGGTGATGACCATATTGAGAAATTACACACTTATGCCCATAGTAGA AATGTTCTTTTTAAATGAAGGAAGAAAAAACAAACTAAATTAATACATGCATATAAACGTCGTCAAAAGTAATATGGGAA TTATTAAAGCTAAATTAATCTAAATTTTAATTTAATATATGGAGGAAAACAAGTTATTGCTATTTTCAATACATGCAACA CCATTTTTTTATCACTAATGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1737042: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17370423189962AA999407MCCE3259.M1FSchistosoma mansoni, cercariae


Date: 13:6:2 on Sun 19 Nov 117.