EST 1737047 is a singleton


Sequence

>1737047 (1 EST) Length=308 ATTATAGATCAATGTATATTTCATTCTTAAACACAACACTTTGAGTTGTCCAGAGAGAGCATCAGTTACACTATGACCTG AGACCATAGAATTGAAAAAGAACGTTTTTTTTAAAAAGAAAGACTAAGCATATCTTGTGATAGTTGCTATGAGAACACTA TAAAATGTAAAGTATATAAGATTACCTGAGTTAAGTATTACTACTATTATTAGTAGTACATTATTGTTATTATTATCATC ACCAGCCGAACAATGAAATAAGTACACTTATATAGAAAAATGATATGGATAGTATTAGAGGATATAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737047: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17370473189967AA999412MCCE3265.M1FSchistosoma mansoni, cercariae


Date: 7:1:43 on Mon 20 Nov 117.