EST 1737077 is a singleton


Sequence

>1737077 (1 EST) Length=247 AAAAAAAATTTGAATTTCTAAAAATCTTACAAATAAATAAATAACAGGTTACTGATTCTCATCATCAATCAACATAGTAA ACAATCATAAAATTTGTCTAAATGTAGTCGTTGTTTTTTTTTCGGTTATTCGCGGGCAATCAATCAAAAGGGGCAAAAAA AAGGGAAAAAATATNANTTTATTAAATAAAATTTTTTCCATGGAAACCTTTATAAATATAACTTTATTTATTTAAATTAA TTTGGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737077: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17370773189997AA999442MCCE3299.M1FSchistosoma mansoni, cercariae


Date: 4:19:52 on Wed 22 Nov 117.