EST 1737082 is a singleton


Sequence

>1737082 (1 EST) Length=411 ATTATTAATTTTATTGTTAATGAAATGGCTATATTTATGTGTAAGAGGCTATAAATATGATGCAGTGATAGAAACAATTC AAAAATTAGTGTCTTATTTTGACTAATAGGCACTTACTAGTCAAATTATATTGTCTTTTTTAATAATATTTTACTCAAAA GTAACTAAATTAAAATCGTTGAAACAAATAAGAAACAAATATTAGTCGTAGCAATAGTACATTGAGTAATAAACTAATTA GAAAGGTCATGTTTATAGAAACCAAGCGCACACACAAGTCAACTTTTATCCTCCCCCCCAATATAATAATCAAACGATAG TTACCTATATGACAAAATGGGTTAATACCAATACTACTATCAGTAATCTAAATACTCATAAATTAGGGAAGATAGAGAGG GCGAATCAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737082: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17370823190002AA999447MCCE3306.M1FSchistosoma mansoni, cercariae


Date: 11:38:26 on Wed 22 Nov 117.