EST 1737084 is a singleton


Sequence

>1737084 (1 EST) Length=466 CTTATGTTAAGCGATTTTATTACAAAGTATACGGTATTAAAATAAAAGAGATAAATAGTAATTAAATAAATCTATTTCAT GTGTCTTGGAAACAGTGTTAATAATGAAAAGTGATCATACGTTTTCGAGATGTTACACTTATGCGTAAAAGTCATCAATG TCTGGGACTGCACCATATCCTCTCGGTCCAAATAGCGTATTATAACAAGGTTCAGTGCAATATAGTCTTCCATCACGTTC TAAGCCACAACCAGGAAGCATGGTTTTATTACATCTGCTGCACTTTAGGCATTGGCGATGCCAGTCACAACCACTCGTGC CGAATTCGGCACGAGTTTTCACTGGTATTGCATTAGAATGGGTCAACCGTACAGAGGCTGCACAACTTTTGAAGCACCTT GATAGAGATAAAAGTGGAAAATTTAGCTCACAAGAGTTAATGGGATTTTTTGCACCCCGTTAAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1737084: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17370843190004AA999449MCCE3308.M1FSchistosoma mansoni, cercariae


Date: 6:11:18 on Fri 24 Nov 117.