EST 1737095 is a singleton


Sequence

>1737095 (1 EST) Length=291 AATTTTTTTGTGTAATTGTATTGTTATAATCTGTTTTGATTTTTGTAAATGTCTAATGACAGAATGTAATAATGAAAAAA AATCCTATTAAAGAAAATAAGTAGCATTTTAGTAATATAGTATCATCTAGAATAATCTTTTTTAGTTTTCTTAAATTCTG ATCAGAGAAATATAAATGATGCTATAGAATAGAAACAATATTGATACAAGTAATACACATATATACTTGTATATAAGCNA GANATAAGANCAATGGTGTATACTCTGTGTGTAATATGTGCATGGTATCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737095: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17370953190015AA999460MCCE3324.M1FSchistosoma mansoni, cercariae


Date: 21:10:32 on Sun 19 Nov 117.