EST 1737108 is a singleton


Sequence

>1737108 (1 EST) Length=440 AATTTTAATCAACTGATTTATTTAGTTATGATAAAACGTATCAAACAAATGAGAAACATGAAAAAAATTCCTTTCAATTA AAAAAAGGACAAAAAAGAGAGGAACAATGAAGTATTGTCTTATCACTATTTTTTTTTTCAGTCTTTTCATCTTGTACAAC TATTACCAGATAGAATGTAATAAACAATTATATTCTGTATAAATACTGATGGTATCTGAATAAAAAAAAATCATTCAGTG TGCAGAGTTTGTGTTCTATTTTCGGTAGAAATATAATAGTTCAAGTTTATTTATTTGTATGGGTTCTTTTGATAAAAATT TTCTACTAATAAACTTTTACACCTGCCACCCCCCCGAAACGTCTTACATACAAAAAGGAATTTACACAGAAAATTTGATG AAACTAATAGGATTATTTTAAAGACTTCAATCCAAACAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737108: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17371083190028AA999473MCCE3345.M1FSchistosoma mansoni, cercariae


Date: 8:25:37 on Fri 24 Nov 117.