EST 1737115 is a singleton


Sequence

>1737115 (1 EST) Length=331 AATCTAATTTATTTATTTAATATCAATGAGATAATGTAAACGTTCAAAGAACCTTTAGAAAATTTCTTACATGAAGAAAA TGAGATTTGGATATTGTTATCAAACCAATAAATAATGTCATATATAAAANAACTGGAGGNACTACAAGGTGATCGAAAAG TTAAATAAAATTAATCATTTAAAACAACTGATAAAAAGGTTTTTGTAGTTTAATCAACAAACTTAATATAAGTGAATAAT ACATCAAAAGAAACACAGGATTGGTTAATTTTAAATGAATACTGATTGCATAAGCATCTGTAATATTGTAAAATGTATTT TATTTAAAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737115: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17371153190035AA999480MCCE3355.M1FSchistosoma mansoni, cercariae


Date: 4:36:49 on Sat 25 Nov 117.