EST 1737116 is a singleton


Sequence

>1737116 (1 EST) Length=346 AATCAAATCACATTTATATTAATTAATTAGTTATGTTTTCAATTAGAAAACTATTTGCCATTAAATAATTTTGGGTTATT CATTAACATTAACCGATTATAATTAATCAAGTCAATCATTACATACAAGATTATATGATCATAAATGACCATTACATTCC AATTTAGAAGACATCCATGCTTCAATTTCTTCAATAGTCCTTTTAACGTCTGTTAATAATTCATGACCAGTTTCAGTGAC AATAATGTTGTCTTCAATTCTTACACCGCCAAATTTTCTAAATCTTTCAATTTGGCTTCTGTCAATAAATTTACTAAGTA TATCCGACGATAAAGCTTCTCGTGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1737116: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17371163190036AA999481MCCE3356.M1FSchistosoma mansoni, cercariae


Date: 18:18:23 on Fri 17 Nov 117.