EST 1737125 is a singleton


Sequence

>1737125 (1 EST) Length=380 GTAATACTTCCCTAATTCCTAATAACGTAACAAGAACACCACTCGTAATCCCTAAATAAATCCCNTTCCGTAACTAAATC AGAAACCCAATTTATTACGATAAAGAACCCAACCCTGGGGCTTAACACCCGGGTCCTTAAACTACAAACTCCATTGAAAG ATTTTAAAAAAGTCCGAAACAAGACTTTCCCTTTTTTCCCAGCCCTCTAACACCCGAAAAAGGGTTCAAACAAAGCCAAA CATCCGAGGGTAAGTAAATAAAACAGATTCAATAGGGACCTCCTCCCCTGGTCCCTTTTAACTCCAGTTTATCCCCCAAG GGTAAACTTTTATCCCTTTTTAACCCATTGAAGGGGTTCTAAAAAAATAAAATGGAATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737125: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17371253190045AA999490MCCE3384.M1FSchistosoma mansoni, cercariae


Date: 20:13:4 on Sat 18 Nov 117.