EST 1737126 is a singleton


Sequence

>1737126 (1 EST) Length=223 AATAAGAAATTGTTTACTCGATGTCTGTTCTTTAAGAGAAAAAGTACTGATTGTTTTCCTTCTGCATCCTGTCCTTTGCA GACCCCGGTTTGTTGACTCTGGGCCTGAGGTTTGCTGGAGTCTCTCCTGAACGTGACGTCCAGGTTTTTGAGGAAGATAT TCATCGCCTCTAAGAGGCTCATTGGAGGAGAAGCAACGCTGGTAAACGCCAGGCTCTCCTCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1737126: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17371263190046AA999491MCCE3387.M1FSchistosoma mansoni, cercariae


Date: 6:56:4 on Mon 20 Nov 117.