EST 1737131 is a singleton


Sequence

>1737131 (1 EST) Length=199 GAAGGTGTACTCAATTATATGTTTAAATGAATCTAACAAATAATACAAGGTAGTAATAGCAATAATTATACAATTAATAA AACGAATGCCTTCTACTAGTAATCTCTATTATTCTCTGGTACCGTGTTTGATAAGTTGAATATGTTCATTCGTTTTTAGT TACTTTACAATGTTTTTGAAAGAAATAACAACAATTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737131: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17371313190051AA999496MCCE3396.M1FSchistosoma mansoni, cercariae


Date: 15:6:40 on Fri 24 Nov 117.