EST 1737132 is a singleton


Sequence

>1737132 (1 EST) Length=344 ACTTCAAACATATTTATTAATAGGAAGCAAGGTGAAAAAACCATATGTCATCGGTTATTATTCAAAAAGAAGCCAAAGTA ATTTTTAACGTTAATTCTGTTGGAATTAAGATAAAGCTTTGAAATAAAATCAACAATATAATGAGCTGATGTCAGTATAC CAGTTTTTATGAACAAAAAGAATCTTTAGTAAGGAGTATCCATAAGACAGGCCATCATATAATCAGAACCCCAGTGCCTT TTTACAAAATGTGTTGTTCCAAAATGTAAAAATTACATAATTTCTGAAGACTACAAATGTGTATGAAAGTGTTCAATAAA TAGTTTACTGTTTATATCCTTGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1737132: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17371323190052AA999497MCCE3399.M1FSchistosoma mansoni, cercariae


Date: 0:47:55 on Thu 23 Nov 117.